Putative DNA quadruplex formation within the human c-kit oncogene.

Abstract

Putative DNA Quadruplex Formation within the Human c-kit Oncogene Sarah Rankin, Anthony P. Reszka, Julian Huppert, Mire Zloh, Gary N. Parkinson, Alan K. Todd, Sylvain Ladame, Shankar Balasubramanian, and Stephen Neidle* Contribution from the Cancer Research UK Biomolecular Structure Group, The School of Pharmacy, University of London, 29-39 Brunswick Square, London WC1N 1AX, UK, and University Chemical Laboratory, University of Cambridge, Lensfield Road, Cambridge CB2 1EW, UK stephen.neidle@ulsop.ac.uk Received February 8, 2005 Abstract: The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.